| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.103515 |
| Chromosome: | chromosome 4 |
| Location: | 221992 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217350 | KUP4 | (1 of 5) K03549 - KUP system potassium uptake protein (kup); Potassium ion uptake transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTCGTCACGTACGTACGTTTGAAATGA |
| Internal bar code: | GGCCTGAGGTTGACGAGGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 218 |
| LEAP-Seq percent confirming: | 68.8645 |
| LEAP-Seq n confirming: | 1128 |
| LEAP-Seq n nonconfirming: | 510 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATCTCCGCCACATACACCT |
| Suggested primer 2: | CTACTTGGAGCCCTGTACGC |