Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.103549 |
Chromosome: | chromosome 16 |
Location: | 7587370 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g689423 | (1 of 14) PF00892 - EamA-like transporter family (EamA); Putative UDP-galactose transporter | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCCATCATTATGAATGAGTAAGCGGCAG |
Internal bar code: | AAAGGGGAAGGGCTGGCCAGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 730 |
LEAP-Seq percent confirming: | 98.3723 |
LEAP-Seq n confirming: | 3324 |
LEAP-Seq n nonconfirming: | 55 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGCTACGCCTTCACTTCTT |
Suggested primer 2: | ATTGTAGGCCATTGTCCAGC |