| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.103578 |
| Chromosome: | chromosome 1 |
| Location: | 5307319 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037150 | CLV6 | (1 of 1) PTHR11689//PTHR11689:SF14 - CHLORIDE CHANNEL // CHLORIDE CHANNEL PROTEIN 2; ion channel/ voltage-gated chloride channel | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTGCATCTCGCACACGGGGATGGATGGC |
| Internal bar code: | ACGCGCCTCTGACGGGCGCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 98.9717 |
| LEAP-Seq n confirming: | 1540 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCGGTGCGAGTACTATTG |
| Suggested primer 2: | TCGCTGTTGGTCGAATGTAG |