Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.103581 |
Chromosome: | chromosome 4 |
Location: | 1787861 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g212050 | (1 of 2) IPR000104//IPR000253//IPR008984 - Antifreeze protein, type I // Forkhead-associated (FHA) domain // SMAD/FHA domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGGAGGGGAAGGCAGGAAGAGGGGGGT |
Internal bar code: | GGCTGCTGCGCATCTTGGGAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 402 |
LEAP-Seq percent confirming: | 93.75 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCAGGAAGAACTGAGCATC |
Suggested primer 2: | GACTTGCTTCCTTGCGTTTC |