| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.103642 |
| Chromosome: | chromosome 8 |
| Location: | 4577369 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g383000 | (1 of 1) IPR000104//IPR001471//IPR016177//IPR031112 - Antifreeze protein, type I // AP2/ERF domain // DNA-binding domain // AP2-like ethylene-responsive transcription factor | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGGGCAGCTGCCCACCCACCCAAGTCA |
| Internal bar code: | GACGCCCTTTTGATCTTCGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 176 |
| LEAP-Seq percent confirming: | 41.3902 |
| LEAP-Seq n confirming: | 262 |
| LEAP-Seq n nonconfirming: | 371 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCTCCTCATAATGGCTG |
| Suggested primer 2: | CACCATCTCCCACCACTACA |