Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.103653 |
Chromosome: | chromosome 1 |
Location: | 6689304 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g048050 | COA3,COAB1,PPCS1 | (1 of 1) 6.3.2.5 - Phosphopantothenate--cysteine ligase / Phosphopantothenoylcysteine synthetase; Phosphopantothenate-cysteine ligase, CoA biosynthesis | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATAACGTACGCGCATAAGTGCAGAATGAA |
Internal bar code: | GTGAGTGGTTTGTGCGATTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 326 |
LEAP-Seq percent confirming: | 93.8534 |
LEAP-Seq n confirming: | 1191 |
LEAP-Seq n nonconfirming: | 78 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCATATGACCATAGCCCAC |
Suggested primer 2: | TGTACAGACGAGACTTGGCG |