Insertion junction: LMJ.RY0402.103711_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.103711
Chromosome:chromosome_6
Location:5288124
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g282800 ICL1 Isocitrate lyase antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GTAACAAAACACGGTCCTGTTCAGCCCAGA
Internal bar code:TGGCGCGTGATGCCCGGCAGCA

Confirmation - LEAP-Seq

LEAP-Seq distance:689
LEAP-Seq percent confirming:95.1057
LEAP-Seq n confirming:4003
LEAP-Seq n nonconfirming:206
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:CGATGTCCTGTCACCTCAGA
Suggested primer 2:GCTACTTCGACCTGGTCAGC