Insertion junction: LMJ.RY0402.103711_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.103711
Chromosome:chromosome_6
Location:5288124
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g282800 ICL1 Isocitrate lyase antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GACTAACGATTGTTTTGGGAGGACTGTTGC
Internal bar code:TTGACAGTTGCTTTGCGCTTAG

Confirmation - LEAP-Seq

LEAP-Seq distance:480
LEAP-Seq percent confirming:99.4382
LEAP-Seq n confirming:3363
LEAP-Seq n nonconfirming:19
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:CGATGTCCTGTCACCTCAGA
Suggested primer 2:GCTACTTCGACCTGGTCAGC