| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.103749 |
| Chromosome: | chromosome 16 |
| Location: | 4823651 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686200 | TSPSP2,TPT1,TPS3,TSSP2 | (1 of 2) K16055 - trehalose 6-phosphate synthase/phosphatase (TPS); Triose-phosphTrehalose-6-phosphate synthase/phosphataseate transporter, class II | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCAGGGGGAGCAGGGCAGAGCAGAGCA |
| Internal bar code: | GGCAGTCGCCCTCCGGAATATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 639 |
| LEAP-Seq percent confirming: | 98.923 |
| LEAP-Seq n confirming: | 1194 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCATGAATGAAACCTCCGC |
| Suggested primer 2: | ACTTTGTACTGGTTTGCGGG |