| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.103791 |
| Chromosome: | chromosome 17 |
| Location: | 3568663 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725550 | GLD1 | Glucose-6-phosphate-1-dehydrogenase; (1 of 2) 1.1.1.49 - Glucose-6-phosphate dehydrogenase (NADP(+)) / GPD | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGTGAAGTCGTAGCCCGGCAGTGTGGGG |
| Internal bar code: | GGCCAGCTGCAAGGGCCGAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 94.1716 |
| LEAP-Seq n confirming: | 3490 |
| LEAP-Seq n nonconfirming: | 216 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | COULD_NOT_FIND_PRIMER |
| Suggested primer 2: | TTGGCTTTTGGTTAGGGTTG |