| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.103795 |
| Chromosome: | chromosome 9 |
| Location: | 5909487 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402515 | AMX1 | (1 of 2) 1.4.3.21 - Primary-amine oxidase / Copper amine oxidase; Copper amine oxidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGAAAACATAGTGCAAAGAGTGTGTGTG |
| Internal bar code: | TCCCTGTCTAGAGCCTCGGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 6.86275 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 285 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTAAGGAATTTGAGCGG |
| Suggested primer 2: | GGGAATTGCCACTGAGATGT |