| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.103811 |
| Chromosome: | chromosome 16 |
| Location: | 2061154 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657250 | GOX17,GOX19 | Glyoxal oxidase 19; (1 of 12) 1.1.3.9 - Galactose oxidase / Beta-galactose oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGGGCAGACAGCAGGCGAGGGCACACT |
| Internal bar code: | AAAGGCAGCATGGGATTGGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 292 |
| LEAP-Seq percent confirming: | 99.2531 |
| LEAP-Seq n confirming: | 2525 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCCCAAAATGTTTCACTC |
| Suggested primer 2: | GAATGGATCGATGGCTAGGA |