| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.103835 |
| Chromosome: | chromosome 9 |
| Location: | 4125879 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393691 | KDG4 | (1 of 1) 2.7.1.138 - Ceramide kinase / Acylsphingosine kinase; Diacylglycerol/ceramide/sphingosine kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATTCTGGGCAGGTGCAGGTTCGGGGGCG |
| Internal bar code: | GTAACATTCGTCCACCGGCCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 171 |
| LEAP-Seq percent confirming: | 98.8212 |
| LEAP-Seq n confirming: | 503 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAGAAGCAAAATGAGCCC |
| Suggested primer 2: | TTTAGAAGCCGTTGTCCCAC |