| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.103921 |
| Chromosome: | chromosome 14 |
| Location: | 1219253 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616200 | GTR14,PIGM1,PIG-M | (1 of 1) K05284 - phosphatidylinositol glycan, class M (PIGM); Alpha-(1-4)-Mannosyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACTCATGCTCATGCTCATTGTCTACGTC |
| Internal bar code: | GCCTACGAAGTATGCCCCCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 98.741 |
| LEAP-Seq n confirming: | 549 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTAAGTGGATGGCGAATC |
| Suggested primer 2: | AACATCAGCAACACTCAGCG |