| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.103994 |
| Chromosome: | chromosome 3 |
| Location: | 2848980 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162550 | MSN1 | methylthioadenosine nucleosidase; (1 of 1) 2.4.2.28//3.2.2.9 - S-methyl-5'-thioadenosine phosphorylase / MTAPase // Adenosylhomocysteine nucleosidase / S-adenosylhomocysteine/5'-methylthioadenosine nucleosidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCCCCACCTCCCGCCGGCCAGGCCCAC |
| Internal bar code: | GCTCACTGATCATGTGATATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 330 |
| LEAP-Seq percent confirming: | 91.954 |
| LEAP-Seq n confirming: | 80 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCAAGTCCCAAATGTAGT |
| Suggested primer 2: | CCATGCATTTGTCCGTGTAG |