| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.104049 |
| Chromosome: | chromosome 6 |
| Location: | 5868560 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g287950 | SRH13 | (1 of 1) K10779//K10876 - transcriptional regulator ATRX [EC:3.6.4.12] (ATRX) // RAD54-like protein 2 [EC:3.6.4.12] (RAD54L2); SNF2-related DNA/RNA helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCCCCGCCCAGCCGCTCTGCGCCCAA |
| Internal bar code: | AGGGAATGTAGGTCGTATGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 640 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 70 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGACGGTAATTGAACCGCT |
| Suggested primer 2: | GTGGATGAGGATGAGGAGGA |