| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.104070 |
| Chromosome: | chromosome 1 |
| Location: | 553428 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g003100 | (1 of 1) IPR001623//IPR011011 - DnaJ domain // Zinc finger, FYVE/PHD-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACGAAACCTGTCTCAGGCCGCACAGACA |
| Internal bar code: | GGTAGTCCCAATCAGACAAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 72 |
| LEAP-Seq percent confirming: | 0.523256 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 1711 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTGCAGAGTGCTATGGGA |
| Suggested primer 2: | CCTCGTGATGACCGTTACCT |