Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.104083 |
Chromosome: | chromosome 13 |
Location: | 4170334 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g592100 | (1 of 1) PF00097//PF00628 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4) // PHD-finger (PHD) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACGAAGAAGTCGCGGCGGGCGCGGAGA |
Internal bar code: | TGCGACACGCCGTCGATCGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 48 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCGAGGCTACCACACCTA |
Suggested primer 2: | ACACAGACGCCCATGTCATA |