Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.104097 |
Chromosome: | chromosome 7 |
Location: | 2214576 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g327200 | (1 of 3) PF00534//PF13579 - Glycosyl transferases group 1 (Glycos_transf_1) // Glycosyl transferase 4-like domain (Glyco_trans_4_4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTATCAGGATGTGGGAACCCCGCAGCAGT |
Internal bar code: | ATGCAAGGTTAGGGTCAGAGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 442 |
LEAP-Seq percent confirming: | 18.1818 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCTCAGGTCAAGCAGAAAC |
Suggested primer 2: | GCATGTTTCTGCAGGTGCTA |