Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.104117 |
Chromosome: | chromosome 3 |
Location: | 7722780 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g203500 | Protein tyrosine kinase; (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCACACACGCGCATCACCGCGGTGGCAC |
Internal bar code: | AGCGACTTCAGTCGGGGATAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 682 |
LEAP-Seq percent confirming: | 99.0045 |
LEAP-Seq n confirming: | 3779 |
LEAP-Seq n nonconfirming: | 38 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTTCATCACTTGCGCTGAC |
Suggested primer 2: | CGCCCAGTTACCTTGTTCAT |