| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.104136 |
| Chromosome: | chromosome 10 |
| Location: | 3983683 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g448750 | GT90F21,GT90-21 | (1 of 11) 2.4.2.26 - Protein xylosyltransferase / Uridine diphosphoxylose-protein xylosyltransferase; GT90 family protein 21 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCATCAGTAACGTGTGCTCTGACTTGT |
| Internal bar code: | GTTGCCCCGGGACCGGGCCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 631 |
| LEAP-Seq percent confirming: | 98.5135 |
| LEAP-Seq n confirming: | 4374 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCACTGGCTTTCTCCTTC |
| Suggested primer 2: | TTATTTACGGGCCGAGTCAC |