Insertion junction: LMJ.RY0402.104145_2


Insertion cassette:CIB1
Side of cassette:5'
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCGTGGGAGGACGCCGCGTTGGCGAGAGC

Confirmation - LEAP-Seq

LEAP-Seq distance:217
LEAP-Seq percent confirming:99.7828
LEAP-Seq n confirming:919
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR