| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.104163 |
| Chromosome: | chromosome 16 |
| Location: | 7305828 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684043 | ALDH24,ALDH24A1 | (1 of 1) 1.2.1.47 - 4-trimethylammoniobutyraldehyde dehydrogenase; Aldehyde dehydrogenase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCTCAGTCTTAGTCGTCTTACTTGCTC |
| Internal bar code: | CCGCTTTCATGCCCAACAAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 739 |
| LEAP-Seq percent confirming: | 99.4516 |
| LEAP-Seq n confirming: | 1088 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGATAGATGGCAGGGAC |
| Suggested primer 2: | TAATCTGTGCGTTGCTGGAG |