| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.104257 |
| Chromosome: | chromosome 2 |
| Location: | 2342585 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g090850 | CLPB3 | (1 of 1) PTHR11638//PTHR11638:SF121 - ATP-DEPENDENT CLP PROTEASE // CHAPERONE PROTEIN CLPB3, CHLOROPLASTIC; ClpB chaperone, Hsp100 family | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCACGCCCACGCCCATCCCACGCCCCG |
| Internal bar code: | CTCTCACTGGAGTTCGCGGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 149 |
| LEAP-Seq percent confirming: | 78.7402 |
| LEAP-Seq n confirming: | 700 |
| LEAP-Seq n nonconfirming: | 189 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTAGGGAGTGGCGTAGCTG |
| Suggested primer 2: | CCTGCACATGCATACCAAAC |