Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.104406 |
Chromosome: | chromosome 3 |
Location: | 7874810 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g202550 | ELG11 | Exostosin-like glycosyltransferase 11; (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATGGGACACATGCGAGTCGTGTGAGCAG |
Internal bar code: | AGTTGGGTACACTATTGGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 766 |
LEAP-Seq percent confirming: | 98.7239 |
LEAP-Seq n confirming: | 1702 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCGGCTCGTGATAGACAG |
Suggested primer 2: | GCAGGTTAAGCACCTGAAGC |