| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.104498 |
| Chromosome: | chromosome 10 |
| Location: | 5520979 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g459350 | OPR49,RAP5 | OctotricoPeptide Repeat protein 49; (1 of 2) IPR000104//IPR013584 - Antifreeze protein, type I // RAP domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCTCCCGCAGGCTCCCGCGTGCGGATCC |
| Internal bar code: | CGCCTTGCGTGGATAATCAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 98.8827 |
| LEAP-Seq n confirming: | 354 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGTTTAGTTTGGGCTGG |
| Suggested primer 2: | GCAGCTCTAACAGATGCACG |