| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.104700 |
| Chromosome: | chromosome 9 |
| Location: | 3782806 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391430 | (1 of 2) IPR015848 - Polyribonucleotide nucleotidyltransferase, RNA-binding domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGGTAAGGTGTGCCGAAACCCTTCTCC |
| Internal bar code: | GCATCCGGAGCCGGCTTAGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 459 |
| LEAP-Seq percent confirming: | 96.9722 |
| LEAP-Seq n confirming: | 8263 |
| LEAP-Seq n nonconfirming: | 258 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTACCCCCTCCCTAGCTT |
| Suggested primer 2: | TCGAAGTAGACGTGGTGCTG |