| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.104927 |
| Chromosome: | chromosome 6 |
| Location: | 8828298 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310400 | (1 of 1) PF14922 - Protein of unknown function (FWWh) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCATCAGGCGTCTGCAATGGGCCTGGCG |
| Internal bar code: | GTGGGCTGCAATACTACAAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 974 |
| LEAP-Seq percent confirming: | 99.8464 |
| LEAP-Seq n confirming: | 7800 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGAGCGCTGAAACTTTTAC |
| Suggested primer 2: | CCTTTTGGTGGTTGGCTTTA |