Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.105000 |
Chromosome: | chromosome 16 |
Location: | 5950012 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676900 | UAA5 | UDP-galactose transporter; (1 of 2) K15276 - solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2 (SLC35B2, PAPST1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGTCCGAGATACGGTGGTGGCAGGGGGC |
Internal bar code: | GGGACGACTCGCAGACATAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 689 |
LEAP-Seq percent confirming: | 98.8883 |
LEAP-Seq n confirming: | 3736 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGTTAGCAGCCATAACCCG |
Suggested primer 2: | ACACGCACACACACACACAC |