| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.105055 |
| Chromosome: | chromosome 11 |
| Location: | 2558746 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g476150 | Glutamine cyclotransferase; (1 of 1) 2.3.2.5 - Glutaminyl-peptide cyclotransferase / Glutaminyl-tRNA cyclotransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTAAGCGCTTTGGGCCTGCATGTGATT |
| Internal bar code: | CGAAGGGTCATTCGCCAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 638 |
| LEAP-Seq percent confirming: | 98.8111 |
| LEAP-Seq n confirming: | 748 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGATTCCCTGGATCAACGA |
| Suggested primer 2: | TGTGCTTTGAATGCTTCCAG |