Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.105111 |
Chromosome: | chromosome 3 |
Location: | 2492601 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g159700 | (1 of 1) PF04750 - FAR-17a/AIG1-like protein (Far-17a_AIG1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAATCGCAAGCGCAAACCCCAGCTTCCTC |
Internal bar code: | ACCTCGGAAGTTTACGGAAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 749 |
LEAP-Seq percent confirming: | 98.7805 |
LEAP-Seq n confirming: | 81 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTAATCGTGGTTGTTGTGC |
Suggested primer 2: | GACTAGGCGCTTAATGCAGG |