| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.105251 |
| Chromosome: | chromosome 16 |
| Location: | 7629008 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689647 | AGO3 | (1 of 2) K11593 - eukaryotic translation initiation factor 2C (ELF2C, AGO); Argonaute-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCCACGTTTCCCCCCCTTTCCTCCACC |
| Internal bar code: | GGCACCGGCTTCGGCTCGAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 445 |
| LEAP-Seq percent confirming: | 99.3909 |
| LEAP-Seq n confirming: | 979 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGGCACTTCATACTTTGT |
| Suggested primer 2: | CCCTGTAGAACTCCAGCAGC |