Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.105333 |
Chromosome: | chromosome 8 |
Location: | 3494282 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g375000 | DSP | (1 of 1) PF09192 - Actin-fragmin kinase, catalytic (Act-Frag_cataly); Dual-Specificity Protein Phosphatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCAGGAGCCCACCCAGTCACATAAATG |
Internal bar code: | AGTGCAAGAGTGGTTCTCGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 339 |
LEAP-Seq percent confirming: | 93.6454 |
LEAP-Seq n confirming: | 3021 |
LEAP-Seq n nonconfirming: | 205 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACTCACTTGACGTGCTCCA |
Suggested primer 2: | TGGGGATGGGGTTGTAGATA |