Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.105350 |
Chromosome: | chromosome 17 |
Location: | 716498 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g701050 | (1 of 1) PF08790//PF12874 - LYAR-type C2HC zinc finger (zf-LYAR) // Zinc-finger of C2H2 type (zf-met) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGAGTCGGAGGAGGAGGAAGAGGTGCC |
Internal bar code: | ATCAGTGCTCGCGGGGAGGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 195 |
LEAP-Seq percent confirming: | 71.7949 |
LEAP-Seq n confirming: | 28 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCAGCACATAGAACCCTG |
Suggested primer 2: | CTTCGTCTTCGGACGATAGC |