| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.105560 |
| Chromosome: | chromosome 3 |
| Location: | 2806993 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162250 | RAD1,CGL35,RAD17 | Conserved in the Green Lineage; (1 of 1) K02830 - cell cycle checkpoint protein (HRAD1, RAD17) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGTAAAGTGCAACACCAAGGGATGCA |
| Internal bar code: | TTGAAGTCCTCGCGAGGAGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 270 |
| LEAP-Seq percent confirming: | 61.8762 |
| LEAP-Seq n confirming: | 930 |
| LEAP-Seq n nonconfirming: | 573 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGACACAGACACTCCCCC |
| Suggested primer 2: | GGCTGCTGATTTTGATGGAT |