| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.105601 |
| Chromosome: | chromosome 17 |
| Location: | 3899769 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728300 | FAP226,CAL6 | Flagellar Associated Protein 226; (1 of 3) 3.4.22.54 - Calpain-3 / Muscle-specific calcium-activated neutral protease 3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGTGGGCAACTACCACTACCTCAACGG |
| Internal bar code: | TACTTTGGCTGAGAGCGGTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 583 |
| LEAP-Seq percent confirming: | 99.4475 |
| LEAP-Seq n confirming: | 720 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCTTCGTTGGTTTTGGTT |
| Suggested primer 2: | TGCGTTCCTCTCACTGACAC |