Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.105601 |
Chromosome: | chromosome 17 |
Location: | 3900022 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g728300 | FAP226,CAL6 | Flagellar Associated Protein 226; (1 of 3) 3.4.22.54 - Calpain-3 / Muscle-specific calcium-activated neutral protease 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGTCCGGTTTAGTTCGGGCTGGTATTTG |
Internal bar code: | CGCTGCCACCAGGACGGTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 0.0818331 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1221 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCTTCGTTGGTTTTGGTT |
Suggested primer 2: | TGGGCCAGGTAGTACGGTAG |