| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.105618 |
| Chromosome: | chromosome 12 |
| Location: | 581244 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492650 | FAS2 | (1 of 10) PTHR10900 - PERIOSTIN-RELATED; Fasciclin-like protein 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAACAGCACCACCGGCCCCAACATCACC |
| Internal bar code: | TTTTGAGGCGAGCGAGGCACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 796 |
| LEAP-Seq percent confirming: | 98.9882 |
| LEAP-Seq n confirming: | 1761 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCTTCAGGCTACGGAGG |
| Suggested primer 2: | ATGGCGTGGTAGGTGAAGAC |