Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.105631 |
Chromosome: | chromosome 6 |
Location: | 2225330 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g266300 | (1 of 15) PTHR12291//PTHR12291:SF23 - FAMILY NOT NAMED // PROTEIN MEC-15 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTAGCGTTGGAGGCCAGCTGGTTTGGGC |
Internal bar code: | GTCGGCCCAAGCGTCGTCAGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1157 |
LEAP-Seq percent confirming: | 99.7428 |
LEAP-Seq n confirming: | 17065 |
LEAP-Seq n nonconfirming: | 44 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCCCATCGCTCATAGTTGC |
Suggested primer 2: | AGCAGCGGAACCGTATAAGA |