Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.105719 |
Chromosome: | chromosome 7 |
Location: | 2173041 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g326800 | PPP29,PP5,CCPP5 | Co-chaperone protein p5 of HSP90; (1 of 1) PTHR11668:SF21 - SERINE/THREONINE-PROTEIN PHOSPHATASE 5 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCCCAGGTCAAGGCCAAGTACAACGGC |
Internal bar code: | GTGAGAGGGGTAGATACGACGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 219 |
LEAP-Seq percent confirming: | 94.0278 |
LEAP-Seq n confirming: | 14469 |
LEAP-Seq n nonconfirming: | 919 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATGAGAACTGGGGTCGGAG |
Suggested primer 2: | GACACCACTGCCAACATCAC |