Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.105721 |
Chromosome: | chromosome 2 |
Location: | 4624247 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g101100 | (1 of 1) PF09756 - DDRGK domain (DDRGK) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGAGTGTGGCGGAGCGCGCCGCCAGCTC |
Internal bar code: | CAAGAGCATGGTCTATAACTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 376 |
LEAP-Seq percent confirming: | 98.6025 |
LEAP-Seq n confirming: | 635 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCATCAAGGGGCGTAAGAC |
Suggested primer 2: | GCCCGAATGTACGAATGAGT |