Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.105806 |
Chromosome: | chromosome 14 |
Location: | 977638 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g614000 | CGL17 | Conserved in the Green Lineage; (1 of 1) PTHR35699:SF1 - F2J10.10 PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAAAGATGCTCTGAGCCTGCACACAGTT |
Internal bar code: | TCGGCAAGCGAGTGGTGATAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 676 |
LEAP-Seq percent confirming: | 98.747 |
LEAP-Seq n confirming: | 1655 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTCCTGGGCTTTTGTGTT |
Suggested primer 2: | TCCCCTATAACTCCAACCCC |