| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.105868 |
| Chromosome: | chromosome 13 |
| Location: | 3919812 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g590600 | PDE32 | (1 of 1) IPR000104//IPR002073//IPR023088 - Antifreeze protein, type I // 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain // 3'5'-cyclic nucleotide phosphodiesterase; 3'%252C5'-cyclic-nucleotide phosphodiesterase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTGGTCAGAGGCTGTATGTCCAGTGCTC |
| Internal bar code: | AAGCGGTGAAAGAGTCCCCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 886 |
| LEAP-Seq percent confirming: | 97.2656 |
| LEAP-Seq n confirming: | 747 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTCTCTCGTCTGCTTACC |
| Suggested primer 2: | TGGAGTGAAGACACAGTCGC |