Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.105884 |
Chromosome: | chromosome 2 |
Location: | 5899943 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g111500 | (1 of 1) PTHR24056//PTHR24056:SF7 - CELL DIVISION PROTEIN KINASE // CYCLIN-DEPENDENT KINASE-LIKE 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACAACACCGCACGCACCGGGTTTGATGT |
Internal bar code: | TCAAACAAGCGGCGAAATACGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 648 |
LEAP-Seq percent confirming: | 98.5162 |
LEAP-Seq n confirming: | 3851 |
LEAP-Seq n nonconfirming: | 58 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACTTGCAGGTGGAAAATGG |
Suggested primer 2: | ACGCTACAGATCACCCCAAC |