| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.105887 |
| Chromosome: | chromosome 6 |
| Location: | 7460818 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300139 | (1 of 7) IPR010995 - DNA repair Rad51/transcription factor NusA, alpha-helical | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGTATTTCGGCACGCACGGACGTTGTTC |
| Internal bar code: | ATGACACGCAGCACTTGAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 337 |
| LEAP-Seq percent confirming: | 99.5411 |
| LEAP-Seq n confirming: | 4338 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCATGATGCTCACTGCAT |
| Suggested primer 2: | CTTCCGCTCCTGTTGATAGC |