| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.105902 |
| Chromosome: | chromosome 9 |
| Location: | 5652539 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401182 | CGL153 | predicted protein; (1 of 1) K14575 - AAA family ATPase (AFG2, DRG1, SPATA5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTGAATGCGCACGGTGTCGGAAGAGGCT |
| Internal bar code: | TTATGTAGTAAGGCCTCGGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 727 |
| LEAP-Seq percent confirming: | 99.6405 |
| LEAP-Seq n confirming: | 21064 |
| LEAP-Seq n nonconfirming: | 76 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGGTTTGGCACATGTTTG |
| Suggested primer 2: | GTAATCACAACCCACCCACC |