| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.105937 |
| Chromosome: | chromosome 16 |
| Location: | 1108573 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649800 | PPR3,CYCR6 | (1 of 1) PF02984//PF13041 - Cyclin, C-terminal domain (Cyclin_C) // PPR repeat family (PPR_2); PentatricoPeptide Repeat protein 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAACTGAGACCCAGGGGTTTGTGGGCTG |
| Internal bar code: | GGGTGGTTTCGCTCAGCGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 270 |
| LEAP-Seq percent confirming: | 99.8178 |
| LEAP-Seq n confirming: | 1096 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCCACAACACACCATGAG |
| Suggested primer 2: | CACACATGCTAACCGTCACC |