| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.106061 |
| Chromosome: | chromosome 12 |
| Location: | 4152210 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518150 | FAL17 | Expressed protein of unknown function; (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGAAACCCCTGCACTCAGACACCTGCC |
| Internal bar code: | TTATCAAAACTGCGCCCGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 449 |
| LEAP-Seq percent confirming: | 97.8369 |
| LEAP-Seq n confirming: | 2759 |
| LEAP-Seq n nonconfirming: | 61 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTCCATCAAACATCACAG |
| Suggested primer 2: | ACTTGTAACCCAATCTGCCG |