| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.106108 |
| Chromosome: | chromosome 5 |
| Location: | 674768 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g230800 | (1 of 1) PF00176//PF07496 - SNF2 family N-terminal domain (SNF2_N) // CW-type Zinc Finger (zf-CW) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTGTAAAGCTTGAAGGCGTGGCGTCAG |
| Internal bar code: | CAGTAAAGGCGATAGCGGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 477 |
| LEAP-Seq percent confirming: | 99.0036 |
| LEAP-Seq n confirming: | 2484 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCAGTTGTTTGCCTCTG |
| Suggested primer 2: | CTTCACCGATGCCTACAGGT |