Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.106120 |
Chromosome: | chromosome 3 |
Location: | 3895497 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g171250 | (1 of 1) IPR000104//IPR011989//IPR012677//IPR013083 - Antifreeze protein, type I // Armadillo-like helical // Nucleotide-binding alpha-beta plait domain // Zinc finger, RING/FYVE/PHD-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAGATCCTCAACCCTTGAATTTGATCA |
Internal bar code: | GCGCTCGCTCCGGTAATTTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 165 |
LEAP-Seq percent confirming: | 88.0734 |
LEAP-Seq n confirming: | 192 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACTTGCCGTGACAGTCC |
Suggested primer 2: | TACAGGCAAGAGCAGAGGGT |